Research Catalog

Title

AATCATACGAGTTTGCATAACTGAATTGGT

Author

Gibson, William, 1948-

Publication

[New York, NY : Kevin Begos Publishing, c1992]

Items in the Library & Off-site

Details

Additional Authors

• Ashbaugh, Dennis, 1946-
• Begos, Kevin.
• Pettingill, Peter
• Foulkes, Karl.
• Kevin Begos Publishing. pbl
• Sun Hill Press. prt
• Golgonooza Letter Foundry. cmt

Description

[100] p. : ill.; 41 cm. +

Alternative Title

• Agrippa : a book of the dead
• AATCA TACGA GTTTG CATAA CTGAA TTGGT

Subjects

• Typefaces (Type evidence) > Gill Sans. (Monotype)
• DNA in art
• Ashbaugh, Dennis, 1946-
• Memory > Poetry
• Artists' books > United States

Genre/Form

• Artists' books – United States.
• Typefaces (Type evidence) – Gill Sans. (Monotype).

Note

• 95 copies printed.
• Poem by William Gibson, etchings by Dennis Ashbaugh.
• "The deluxe edition of Agrippa was set in Monotype Gill Sans at Golgonooza Letter Foundry, and printed on Rives heavyweight text by the Sun Hill Press and by Kevin Begos Jr. The etchings were made by the artist and editioned by Peter Pettingill on Fabriano Tiepolo paper. The book was handsewn and bound in linen by Karl Foulkes. The housing was designed by the artist, and the encryption code used to destroy the story was created by (BRASH), with help from several other individuals"--Center for Book Arts website, viewed 3/23/05: URL=http://www.centerforbookarts.dreamhosters.com/index.php/Detail/Object/Show/object_id/1187
• Imprint information taken from Internet editions of the poem, e.g. the TOTSE website, viewed 3/23/05: URL=http://www.totse.com/en/ego/science%5Ffiction/agrippa.html
• The ill. are etchings (8 full-page, 1 superimposed on the text), from images incorporating depictions of nucleic acids in green or brown with superimposed imagery from old advertisements. There are two photosensitive images that appear or disappear when exposed to light.
• Final 20 leaves glued together, with cut-out recess enclosing a 3-1/2 in. floppy disk containing the poem, which may be displayed on a computer screen only once, and then is irretrievably encrypted. Once the program on the disk has begun displaying the poem, it cannot be stopped, copied, or printed.
• Binding: Publisher's natural distressed linen boards, with title stamped in brown on front cover, by Karl Foulkes. Issued in a dark brown translucent case (59 x 39 x 8 cm.) composed of resin-impregnated paper and fiberglass, designed by the artist. Top of case lifts off to reveal honeycomb cardboard cutout covered in copper glitter with recess to contain the book, which is partly wrapped in a shroud of cloth netting.

Additional Formats (note)

• The poem is published in its entirety in unencrypted form on the author's website and elsewhere on the Internet.

Language (note)

• Text in book consists of permutations of the letter string C-A-T-G, the symbols for the four bases, cytosine, adenine, thymine, and guanine, that make up the genetic code. Printed in double columns.

Call Number

*KP+++ (Sun Hill) 05-60

OCLC

58653919

Author

Gibson, William, 1948-

Title

AATCATACGAGTTTGCATAACTGAATTGGT

Imprint

[New York, NY : Kevin Begos Publishing, c1992]

Local Note

NYPL has no. 12/95; signed by the author and the artist.

Additional Formats

The poem is published in its entirety in unencrypted form on the author's website and elsewhere on the Internet.

Language

Text in book consists of permutations of the letter string C-A-T-G, the symbols for the four bases, cytosine, adenine, thymine, and guanine, that make up the genetic code. Printed in double columns.

Connect to:

Request access to this item in the Schwarzman Rare Books Collection

Author's authorized electronic version of the full text of the poem

Added Author

Ashbaugh, Dennis, 1946- Illustrator. Etcher

Begos, Kevin. Printer

Pettingill, Peter, printer of plates.

Foulkes, Karl. Binder

Kevin Begos Publishing. Publisher

Sun Hill Press. Printer

Golgonooza Letter Foundry. Compositor

Research Call Number

*KP+++ (Sun Hill) 05-60