Research Catalog
New! Try our Article Search to discover online journals, books, and more from home with your library card.
Displaying 1-5 of 5 results
AATCATACGAGTTTGCATAACTGAATTGGT
- Text
- [New York, NY : Kevin Begos Publishing, c1992]
- 1992
- 1 Item
Item details Format Call Number Item Location Text *KP+++ (Sun Hill) 05-60 Schwarzman Building - Rare Book Collection Room 328 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Klaus U. Hilsbecher : DNA signature : 20.5.2017-12.11.2017, Núcleo de Arte Contemporânea do Museu do Vidro, Marinha Grande, Portugal / [Kurator, Redaktion: Klaus U. Hilsbecher].
- Text
- Berlin : Edition Braus Berlin, 2017.
- 2017
- 1 Item
Item details Format Call Number Item Location Text JQF 19-883 Schwarzman Building - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Lynn Hershman Leeson : twisted / edited by Margot Norton ; curator, Margot Norton ; contributions by Karen Archey, Lynn Hershman Leeson, Margot Norton, Martine Syms.
- Text
- New York, NY : New Museum, [2021]
- 2021-2021
- 1 Item
Item details Format Call Number Item Location Text JQF 22-345 Schwarzman Building - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Martin Sikora / Eske Willerslev : DNArt / redaktion: Christiane Finsen, Inge Merete Kjeldgaard.
- Text
- Esbjerg : Esbjerg Kunstmuseum, [2021]
- 2021
- 1 Item
Item details Format Call Number Item Location Text JQF 22-877 Schwarzman Building - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Lynn Hershman Leeson : Twisted / edited by Margot Norton
- Text
- New York : New Museum of Contemporary Art, 2021
- 2021
- 1 Item
Item details Format Call Number Item Location Text N6537.H398 A4 2021g Off-site
No results found from Digital Research Books Beta
Digital books for research from multiple sources world wide- all free to read, download, and keep. No Library Card is Required. Read more about the project.
